ID: 933326906

View in Genome Browser
Species Human (GRCh38)
Location 2:80849513-80849535
Sequence CATGAATAGCAGAGGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933326899_933326906 6 Left 933326899 2:80849484-80849506 CCACTGCCCACACCTGAAAAGAC No data
Right 933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG No data
933326901_933326906 -1 Left 933326901 2:80849491-80849513 CCACACCTGAAAAGACAACCTTC No data
Right 933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG No data
933326900_933326906 0 Left 933326900 2:80849490-80849512 CCCACACCTGAAAAGACAACCTT No data
Right 933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG No data
933326902_933326906 -6 Left 933326902 2:80849496-80849518 CCTGAAAAGACAACCTTCATGAA No data
Right 933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933326906 Original CRISPR CATGAATAGCAGAGGGTAGC TGG Intergenic
No off target data available for this crispr