ID: 933327381

View in Genome Browser
Species Human (GRCh38)
Location 2:80855370-80855392
Sequence AAGCACATGGGGCAGGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933327381_933327389 12 Left 933327381 2:80855370-80855392 CCTGGATCCTGCCCCATGTGCTT No data
Right 933327389 2:80855405-80855427 TCTGGATGTCCTAAACACCAAGG No data
933327381_933327386 -6 Left 933327381 2:80855370-80855392 CCTGGATCCTGCCCCATGTGCTT No data
Right 933327386 2:80855387-80855409 GTGCTTCACCTTTCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933327381 Original CRISPR AAGCACATGGGGCAGGATCC AGG (reversed) Intergenic
No off target data available for this crispr