ID: 933328462

View in Genome Browser
Species Human (GRCh38)
Location 2:80868125-80868147
Sequence GGCATAGGGATCACTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328462_933328472 20 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328462_933328470 1 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328470 2:80868149-80868171 ATTATAGTTGAGGAAATACTGGG No data
933328462_933328471 9 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328471 2:80868157-80868179 TGAGGAAATACTGGGTAAGTAGG No data
933328462_933328473 23 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328473 2:80868171-80868193 GTAAGTAGGTAGACCCACGGAGG No data
933328462_933328465 -9 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328465 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
933328462_933328469 0 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328469 2:80868148-80868170 CATTATAGTTGAGGAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328462 Original CRISPR GGCATAGGGATCACTCTGAA GGG (reversed) Intergenic
No off target data available for this crispr