ID: 933328463

View in Genome Browser
Species Human (GRCh38)
Location 2:80868126-80868148
Sequence GGGCATAGGGATCACTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328463_933328473 22 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328473 2:80868171-80868193 GTAAGTAGGTAGACCCACGGAGG No data
933328463_933328471 8 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328471 2:80868157-80868179 TGAGGAAATACTGGGTAAGTAGG No data
933328463_933328470 0 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328470 2:80868149-80868171 ATTATAGTTGAGGAAATACTGGG No data
933328463_933328469 -1 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328469 2:80868148-80868170 CATTATAGTTGAGGAAATACTGG No data
933328463_933328472 19 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328463_933328465 -10 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328465 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328463 Original CRISPR GGGCATAGGGATCACTCTGA AGG (reversed) Intergenic
No off target data available for this crispr