ID: 933328464

View in Genome Browser
Species Human (GRCh38)
Location 2:80868139-80868161
Sequence CCTCAACTATAATGGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328464_933328473 9 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328473 2:80868171-80868193 GTAAGTAGGTAGACCCACGGAGG No data
933328464_933328474 18 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data
933328464_933328472 6 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328464_933328471 -5 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328471 2:80868157-80868179 TGAGGAAATACTGGGTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328464 Original CRISPR CCTCAACTATAATGGGCATA GGG (reversed) Intergenic
No off target data available for this crispr