ID: 933328467

View in Genome Browser
Species Human (GRCh38)
Location 2:80868146-80868168
Sequence AGTATTTCCTCAACTATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328467_933328472 -1 Left 933328467 2:80868146-80868168 CCCATTATAGTTGAGGAAATACT No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328467_933328473 2 Left 933328467 2:80868146-80868168 CCCATTATAGTTGAGGAAATACT No data
Right 933328473 2:80868171-80868193 GTAAGTAGGTAGACCCACGGAGG No data
933328467_933328474 11 Left 933328467 2:80868146-80868168 CCCATTATAGTTGAGGAAATACT No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328467 Original CRISPR AGTATTTCCTCAACTATAAT GGG (reversed) Intergenic
No off target data available for this crispr