ID: 933328468

View in Genome Browser
Species Human (GRCh38)
Location 2:80868147-80868169
Sequence CAGTATTTCCTCAACTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328468_933328474 10 Left 933328468 2:80868147-80868169 CCATTATAGTTGAGGAAATACTG No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data
933328468_933328472 -2 Left 933328468 2:80868147-80868169 CCATTATAGTTGAGGAAATACTG No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328468_933328473 1 Left 933328468 2:80868147-80868169 CCATTATAGTTGAGGAAATACTG No data
Right 933328473 2:80868171-80868193 GTAAGTAGGTAGACCCACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328468 Original CRISPR CAGTATTTCCTCAACTATAA TGG (reversed) Intergenic
No off target data available for this crispr