ID: 933328472

View in Genome Browser
Species Human (GRCh38)
Location 2:80868168-80868190
Sequence TGGGTAAGTAGGTAGACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328462_933328472 20 Left 933328462 2:80868125-80868147 CCCTTCAGAGTGATCCCTATGCC No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328467_933328472 -1 Left 933328467 2:80868146-80868168 CCCATTATAGTTGAGGAAATACT No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328463_933328472 19 Left 933328463 2:80868126-80868148 CCTTCAGAGTGATCCCTATGCCC No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328464_933328472 6 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328468_933328472 -2 Left 933328468 2:80868147-80868169 CCATTATAGTTGAGGAAATACTG No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data
933328466_933328472 5 Left 933328466 2:80868140-80868162 CCTATGCCCATTATAGTTGAGGA No data
Right 933328472 2:80868168-80868190 TGGGTAAGTAGGTAGACCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328472 Original CRISPR TGGGTAAGTAGGTAGACCCA CGG Intergenic
No off target data available for this crispr