ID: 933328474

View in Genome Browser
Species Human (GRCh38)
Location 2:80868180-80868202
Sequence TAGACCCACGGAGGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933328468_933328474 10 Left 933328468 2:80868147-80868169 CCATTATAGTTGAGGAAATACTG No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data
933328466_933328474 17 Left 933328466 2:80868140-80868162 CCTATGCCCATTATAGTTGAGGA No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data
933328467_933328474 11 Left 933328467 2:80868146-80868168 CCCATTATAGTTGAGGAAATACT No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data
933328464_933328474 18 Left 933328464 2:80868139-80868161 CCCTATGCCCATTATAGTTGAGG No data
Right 933328474 2:80868180-80868202 TAGACCCACGGAGGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933328474 Original CRISPR TAGACCCACGGAGGTGAGAC AGG Intergenic
No off target data available for this crispr