ID: 933334746

View in Genome Browser
Species Human (GRCh38)
Location 2:80943464-80943486
Sequence AAAAAAGCACAGGCGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933334746_933334753 13 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334753 2:80943500-80943522 AGACACAACTGAAAGGGATTGGG No data
933334746_933334750 6 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334746_933334751 7 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334751 2:80943494-80943516 ATGGTCAGACACAACTGAAAGGG No data
933334746_933334755 26 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334755 2:80943513-80943535 AGGGATTGGGGAGAACCTTAAGG No data
933334746_933334752 12 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334752 2:80943499-80943521 CAGACACAACTGAAAGGGATTGG No data
933334746_933334754 14 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334754 2:80943501-80943523 GACACAACTGAAAGGGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933334746 Original CRISPR AAAAAAGCACAGGCGGAACT AGG (reversed) Intergenic
No off target data available for this crispr