ID: 933334750

View in Genome Browser
Species Human (GRCh38)
Location 2:80943493-80943515
Sequence TATGGTCAGACACAACTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933334744_933334750 26 Left 933334744 2:80943444-80943466 CCCAGAAGATAGGCTTTGAACCT No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334746_933334750 6 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334747_933334750 -1 Left 933334747 2:80943471-80943493 CCGCCTGTGCTTTTTTCAAGATT No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334743_933334750 27 Left 933334743 2:80943443-80943465 CCCCAGAAGATAGGCTTTGAACC No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334748_933334750 -4 Left 933334748 2:80943474-80943496 CCTGTGCTTTTTTCAAGATTATG No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data
933334745_933334750 25 Left 933334745 2:80943445-80943467 CCAGAAGATAGGCTTTGAACCTA No data
Right 933334750 2:80943493-80943515 TATGGTCAGACACAACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933334750 Original CRISPR TATGGTCAGACACAACTGAA AGG Intergenic
No off target data available for this crispr