ID: 933334752 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:80943499-80943521 |
| Sequence | CAGACACAACTGAAAGGGAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933334747_933334752 | 5 | Left | 933334747 | 2:80943471-80943493 | CCGCCTGTGCTTTTTTCAAGATT | No data | ||
| Right | 933334752 | 2:80943499-80943521 | CAGACACAACTGAAAGGGATTGG | No data | ||||
| 933334748_933334752 | 2 | Left | 933334748 | 2:80943474-80943496 | CCTGTGCTTTTTTCAAGATTATG | No data | ||
| Right | 933334752 | 2:80943499-80943521 | CAGACACAACTGAAAGGGATTGG | No data | ||||
| 933334746_933334752 | 12 | Left | 933334746 | 2:80943464-80943486 | CCTAGTTCCGCCTGTGCTTTTTT | No data | ||
| Right | 933334752 | 2:80943499-80943521 | CAGACACAACTGAAAGGGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933334752 | Original CRISPR | CAGACACAACTGAAAGGGAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||