ID: 933334753

View in Genome Browser
Species Human (GRCh38)
Location 2:80943500-80943522
Sequence AGACACAACTGAAAGGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933334748_933334753 3 Left 933334748 2:80943474-80943496 CCTGTGCTTTTTTCAAGATTATG No data
Right 933334753 2:80943500-80943522 AGACACAACTGAAAGGGATTGGG No data
933334747_933334753 6 Left 933334747 2:80943471-80943493 CCGCCTGTGCTTTTTTCAAGATT No data
Right 933334753 2:80943500-80943522 AGACACAACTGAAAGGGATTGGG No data
933334746_933334753 13 Left 933334746 2:80943464-80943486 CCTAGTTCCGCCTGTGCTTTTTT No data
Right 933334753 2:80943500-80943522 AGACACAACTGAAAGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933334753 Original CRISPR AGACACAACTGAAAGGGATT GGG Intergenic
No off target data available for this crispr