ID: 933336202

View in Genome Browser
Species Human (GRCh38)
Location 2:80962957-80962979
Sequence TACCACTGTATTCCAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933336197_933336202 11 Left 933336197 2:80962923-80962945 CCTGTGAGGTGGAGGTTGCAGTG 0: 246
1: 33219
2: 101572
3: 194236
4: 194843
Right 933336202 2:80962957-80962979 TACCACTGTATTCCAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933336202 Original CRISPR TACCACTGTATTCCAGCCTA GGG Intergenic
No off target data available for this crispr