ID: 933337451

View in Genome Browser
Species Human (GRCh38)
Location 2:80976230-80976252
Sequence TGATAAGTAAACAAATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933337445_933337451 23 Left 933337445 2:80976184-80976206 CCCCAAGGAGTGTTTCTTTCCTG No data
Right 933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG No data
933337444_933337451 26 Left 933337444 2:80976181-80976203 CCTCCCCAAGGAGTGTTTCTTTC No data
Right 933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG No data
933337449_933337451 4 Left 933337449 2:80976203-80976225 CCTGGTGATATCAGTATCTAATG No data
Right 933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG No data
933337446_933337451 22 Left 933337446 2:80976185-80976207 CCCAAGGAGTGTTTCTTTCCTGG No data
Right 933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG No data
933337448_933337451 21 Left 933337448 2:80976186-80976208 CCAAGGAGTGTTTCTTTCCTGGT No data
Right 933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933337451 Original CRISPR TGATAAGTAAACAAATTGGC AGG Intergenic
No off target data available for this crispr