ID: 933339311

View in Genome Browser
Species Human (GRCh38)
Location 2:81002424-81002446
Sequence CCTGGCAGCAGAGTTTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933339311_933339316 30 Left 933339311 2:81002424-81002446 CCACTGAAAACTCTGCTGCCAGG No data
Right 933339316 2:81002477-81002499 TCTTTTTTGTTGCTGCTTTTAGG 0: 4
1: 33
2: 447
3: 803
4: 2036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933339311 Original CRISPR CCTGGCAGCAGAGTTTTCAG TGG (reversed) Intergenic
No off target data available for this crispr