ID: 933344093

View in Genome Browser
Species Human (GRCh38)
Location 2:81061347-81061369
Sequence AACTCCTTTCTGTAAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933344087_933344093 28 Left 933344087 2:81061296-81061318 CCCCAAGTTTGAAGCCAGACTAC No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data
933344088_933344093 27 Left 933344088 2:81061297-81061319 CCCAAGTTTGAAGCCAGACTACC No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data
933344089_933344093 26 Left 933344089 2:81061298-81061320 CCAAGTTTGAAGCCAGACTACCA No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data
933344090_933344093 14 Left 933344090 2:81061310-81061332 CCAGACTACCAAGTAGCTGCCAG No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data
933344092_933344093 -5 Left 933344092 2:81061329-81061351 CCAGAGCAGTGTGTCATAAACTC No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data
933344091_933344093 6 Left 933344091 2:81061318-81061340 CCAAGTAGCTGCCAGAGCAGTGT No data
Right 933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933344093 Original CRISPR AACTCCTTTCTGTAAGAAAC AGG Intergenic
No off target data available for this crispr