ID: 933345764

View in Genome Browser
Species Human (GRCh38)
Location 2:81083759-81083781
Sequence CATTTCCTATATACTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933345760_933345764 24 Left 933345760 2:81083712-81083734 CCACTGATTTTATTTGGGTGACT No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data
933345756_933345764 28 Left 933345756 2:81083708-81083730 CCCCCCACTGATTTTATTTGGGT No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data
933345759_933345764 25 Left 933345759 2:81083711-81083733 CCCACTGATTTTATTTGGGTGAC No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data
933345758_933345764 26 Left 933345758 2:81083710-81083732 CCCCACTGATTTTATTTGGGTGA No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data
933345757_933345764 27 Left 933345757 2:81083709-81083731 CCCCCACTGATTTTATTTGGGTG No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data
933345754_933345764 29 Left 933345754 2:81083707-81083729 CCCCCCCACTGATTTTATTTGGG No data
Right 933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933345764 Original CRISPR CATTTCCTATATACTTCCCT GGG Intergenic
No off target data available for this crispr