ID: 933346047

View in Genome Browser
Species Human (GRCh38)
Location 2:81086900-81086922
Sequence ACTTTTCCACAGCACTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933346047_933346050 21 Left 933346047 2:81086900-81086922 CCATTAAAGTGCTGTGGAAAAGT No data
Right 933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG No data
933346047_933346049 8 Left 933346047 2:81086900-81086922 CCATTAAAGTGCTGTGGAAAAGT No data
Right 933346049 2:81086931-81086953 AGCTCATCGGCACTACCCACAGG No data
933346047_933346048 -5 Left 933346047 2:81086900-81086922 CCATTAAAGTGCTGTGGAAAAGT No data
Right 933346048 2:81086918-81086940 AAAGTCTGTTTGTAGCTCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933346047 Original CRISPR ACTTTTCCACAGCACTTTAA TGG (reversed) Intergenic
No off target data available for this crispr