ID: 933346050

View in Genome Browser
Species Human (GRCh38)
Location 2:81086944-81086966
Sequence TACCCACAGGTGCTACTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933346047_933346050 21 Left 933346047 2:81086900-81086922 CCATTAAAGTGCTGTGGAAAAGT No data
Right 933346050 2:81086944-81086966 TACCCACAGGTGCTACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933346050 Original CRISPR TACCCACAGGTGCTACTCAC TGG Intergenic
No off target data available for this crispr