ID: 933348026

View in Genome Browser
Species Human (GRCh38)
Location 2:81115155-81115177
Sequence TATCAAGTGCAGGCCCGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933348022_933348026 13 Left 933348022 2:81115119-81115141 CCATATTTCAAATAAACTAGAAA No data
Right 933348026 2:81115155-81115177 TATCAAGTGCAGGCCCGGCATGG No data
933348023_933348026 -10 Left 933348023 2:81115142-81115164 CCATTTTGAAATATATCAAGTGC No data
Right 933348026 2:81115155-81115177 TATCAAGTGCAGGCCCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933348026 Original CRISPR TATCAAGTGCAGGCCCGGCA TGG Intergenic
No off target data available for this crispr