ID: 933349934

View in Genome Browser
Species Human (GRCh38)
Location 2:81140745-81140767
Sequence CACCGCATCCAGCCACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933349934_933349939 9 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349939 2:81140777-81140799 TGTAATCCCAACACTTTGGGAGG 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
933349934_933349936 5 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349936 2:81140773-81140795 CGCCTGTAATCCCAACACTTTGG 0: 9450
1: 144047
2: 280281
3: 215306
4: 144319
933349934_933349943 18 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349943 2:81140786-81140808 AACACTTTGGGAGGCTGAGGCGG 0: 4553
1: 71403
2: 157146
3: 156377
4: 108777
933349934_933349944 19 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349944 2:81140787-81140809 ACACTTTGGGAGGCTGAGGCGGG 0: 4808
1: 73787
2: 192371
3: 237945
4: 272714
933349934_933349941 15 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349941 2:81140783-81140805 CCCAACACTTTGGGAGGCTGAGG 0: 6542
1: 100102
2: 219941
3: 238271
4: 258571
933349934_933349937 6 Left 933349934 2:81140745-81140767 CCTGTTAGTGGCTGGATGCGGTG No data
Right 933349937 2:81140774-81140796 GCCTGTAATCCCAACACTTTGGG 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933349934 Original CRISPR CACCGCATCCAGCCACTAAC AGG (reversed) Intergenic
No off target data available for this crispr