ID: 933351545

View in Genome Browser
Species Human (GRCh38)
Location 2:81158734-81158756
Sequence ATGGAGAGAGCAGTGACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933351540_933351545 26 Left 933351540 2:81158685-81158707 CCTAGTTACAGATTTATAATTTT No data
Right 933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933351545 Original CRISPR ATGGAGAGAGCAGTGACTGC GGG Intergenic
No off target data available for this crispr