ID: 933352569

View in Genome Browser
Species Human (GRCh38)
Location 2:81173522-81173544
Sequence ACAAATACACTACTCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933352569_933352573 27 Left 933352569 2:81173522-81173544 CCCCACCAGAGTAGTGTATTTGT No data
Right 933352573 2:81173572-81173594 GTGTTATCCCTGAAAGATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933352569 Original CRISPR ACAAATACACTACTCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr