ID: 933355049

View in Genome Browser
Species Human (GRCh38)
Location 2:81199353-81199375
Sequence TGTGCTCCTTGGAGCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933355042_933355049 1 Left 933355042 2:81199329-81199351 CCTCTGGCTTGGCCCTGCAGTCC 0: 1
1: 0
2: 6
3: 35
4: 313
Right 933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG 0: 1
1: 0
2: 4
3: 29
4: 291
933355038_933355049 23 Left 933355038 2:81199307-81199329 CCTCGCGGTGTGCGGTGTGCCTC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG 0: 1
1: 0
2: 4
3: 29
4: 291
933355041_933355049 4 Left 933355041 2:81199326-81199348 CCTCCTCTGGCTTGGCCCTGCAG 0: 1
1: 0
2: 7
3: 27
4: 367
Right 933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG 0: 1
1: 0
2: 4
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933355049 Original CRISPR TGTGCTCCTTGGAGCTCTGG AGG Intergenic
900476970 1:2880482-2880504 TGTTCTCCCTGGACCTGTGGAGG - Intergenic
900602513 1:3509237-3509259 TGTGCCCCTGGCAGCCCTGGAGG - Exonic
900654985 1:3752404-3752426 TGGGCTCCTGGGAGCAGTGGTGG - Exonic
901652937 1:10753445-10753467 TGTGCTCCTTGGGGACATGGAGG - Intronic
901962541 1:12838793-12838815 TGAGCCCCTTGGAGCTCTGCTGG - Intergenic
901969099 1:12893308-12893330 TGAGCCCCTTGGAGTTCTGCTGG - Exonic
903477720 1:23631341-23631363 TGTGGTCCCAGTAGCTCTGGAGG + Intronic
903745496 1:25584153-25584175 TGTGCTCTTTGGAGGTCCCGTGG + Intergenic
904437046 1:30505806-30505828 TGAGTTTCTTGTAGCTCTGGAGG - Intergenic
904967324 1:34385541-34385563 TGTGCTCCTTGTGTCTCTGGTGG - Intergenic
905266012 1:36754946-36754968 GCAGCTGCTTGGAGCTCTGGAGG + Intergenic
905328089 1:37172225-37172247 TGTGCTGCTGGGAGTGCTGGTGG - Intergenic
905883676 1:41480369-41480391 TGTGCCCGTGGGAGCTGTGGAGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906238251 1:44225092-44225114 TTTTCTGCTTGAAGCTCTGGGGG + Intronic
906964663 1:50444458-50444480 TGTGTTCTGTGCAGCTCTGGGGG + Intronic
907784787 1:57600856-57600878 TGTTCACCTTGGCGCTCTGAAGG - Intronic
912332852 1:108835041-108835063 GGTGCTCCTTGGGAATCTGGGGG + Exonic
916006870 1:160670125-160670147 GGTGCTGCTTGGAGTTCGGGGGG - Intergenic
916580560 1:166103763-166103785 GTTCCTCCTTGAAGCTCTGGTGG - Intronic
918110628 1:181452461-181452483 TGTGTTCCTTGGAGCCCTTCAGG + Intronic
918670337 1:187207187-187207209 TGTGATCCTTTGTGCTATGGAGG + Intergenic
922778262 1:228227617-228227639 TGTGCTGCTTGCAGCTCTGGAGG + Intronic
922823628 1:228502069-228502091 TGTGCTGCTCACAGCTCTGGAGG - Intergenic
923013405 1:230106946-230106968 TGGGCTCCTTGTAGCAATGGAGG + Intronic
1062980006 10:1713937-1713959 CGTGCTTCCTGGAGCTCTGAGGG + Intronic
1063396635 10:5693841-5693863 TGTGGTGCTAGGAGCTCTGTTGG + Intronic
1064144305 10:12815518-12815540 TGTGCTCCTCTGAGCTCAGAAGG - Intronic
1064827831 10:19425772-19425794 TGTGGTCCTGGGAGTTGTGGAGG + Intronic
1065395607 10:25233653-25233675 TGTGGTCCTGGGACCCCTGGGGG + Intronic
1065397606 10:25256548-25256570 TGTGGTCCTAGGAACTCAGGAGG + Intronic
1065901029 10:30208059-30208081 TGTACTCCTTGGAGCTACTGTGG - Intergenic
1068804065 10:61174831-61174853 TTTATTCCTTAGAGCTCTGGAGG + Intergenic
1069043438 10:63718301-63718323 TGGGCTCCTGGGTGATCTGGTGG + Intergenic
1069596986 10:69678547-69678569 TATTCACCTTGGAGCCCTGGTGG + Intergenic
1069644740 10:69985603-69985625 TGTGGTCCTAGCTGCTCTGGAGG - Intergenic
1069934365 10:71905195-71905217 TGTGCTCCTGGAGGCTCTAGGGG - Intergenic
1071355409 10:84788908-84788930 TGTGCCCATTGGAGCTATGGGGG + Intergenic
1071679885 10:87694465-87694487 TGTGCTGCTTGGAGAACAGGTGG + Intronic
1073036652 10:100568499-100568521 TGTGCTCCATGGAGCTCTAAGGG - Intergenic
1074848594 10:117420752-117420774 TCTGCTCCTGGGAGCCATGGAGG - Intergenic
1076061987 10:127420167-127420189 TGTTCTCCGTGCACCTCTGGCGG + Intronic
1076699785 10:132265431-132265453 TGTTGCCCTTGCAGCTCTGGTGG - Intronic
1077102245 11:827476-827498 TGTGCTCCCCGAAACTCTGGGGG - Intronic
1077178350 11:1200716-1200738 GGTTCTCCTTGGAGGTCAGGAGG - Intronic
1078131684 11:8619031-8619053 TGTGCTCTGTGTAGCTCTTGAGG - Intronic
1078250857 11:9615165-9615187 TGTGCCCCTTGGAGTTTTGGGGG - Intergenic
1079307480 11:19336246-19336268 AGTGCTCCCTGGGGCTCTGTGGG + Intergenic
1080635927 11:34123150-34123172 GGTGCTCTTTAGAGCTCTGTGGG + Intronic
1084182437 11:67453751-67453773 TGTGTTCCCTGGAACCCTGGGGG - Intronic
1084411659 11:69009446-69009468 TGTGCTCCATGGAGCCTAGGGGG - Intronic
1084558453 11:69889304-69889326 GGTGCTGATGGGAGCTCTGGGGG - Intergenic
1084967155 11:72750796-72750818 GGGTCTCCTTGGAGCTCTGTGGG - Intronic
1086261380 11:84945433-84945455 TGAGCTGCCTGGAGCTATGGAGG + Intronic
1087211181 11:95447363-95447385 TGCGCTCCATGGAGCTGTTGGGG - Intergenic
1087894881 11:103576195-103576217 AGTGTTCCTTGGAGATCTGAAGG + Intergenic
1088122029 11:106381001-106381023 TGTGGTCCCAGGAACTCTGGGGG + Intergenic
1088693352 11:112346102-112346124 GGAGATCCTGGGAGCTCTGGTGG + Intergenic
1089784509 11:120898470-120898492 TTGGCTCCTTCCAGCTCTGGAGG + Intronic
1089846630 11:121463932-121463954 TGTTCTCCTTGGACCTCAGGAGG + Intronic
1090404642 11:126469424-126469446 AGGGCTCCTTGCAGCCCTGGGGG + Intronic
1091329394 11:134719299-134719321 TGTCCTTCCTGGAGCTCTGTAGG + Intergenic
1092933860 12:13341786-13341808 TGTACTTCTTGCAGTTCTGGAGG - Intergenic
1093212838 12:16328108-16328130 TGTATTCCTTGCAGTTCTGGAGG + Intergenic
1096741681 12:53697925-53697947 TTAGCTCCTTGGAGTACTGGAGG - Intergenic
1097359626 12:58644774-58644796 TGTGCACTTTGCAGCTCAGGAGG + Intronic
1099494484 12:83329127-83329149 TGTACTTCTTAGAGTTCTGGAGG - Intergenic
1100271456 12:93029245-93029267 TCTGCTCTCTGGAGCCCTGGGGG - Intergenic
1101754802 12:107613116-107613138 AGTGCTCCTTGCAGCTATGTTGG - Intronic
1103261859 12:119594902-119594924 GGGGCGCCTGGGAGCTCTGGGGG - Intronic
1103385496 12:120529101-120529123 TGTGCTCTATGGAGCTATTGCGG - Exonic
1104117241 12:125761242-125761264 TGTGCTCCCTTGACATCTGGAGG - Intergenic
1104166222 12:126232307-126232329 TGTGCTCCTACAATCTCTGGTGG - Intergenic
1105715693 13:23061899-23061921 TGTGGTCCTAGCAACTCTGGAGG - Intergenic
1106179646 13:27359676-27359698 TGTGGTCCTGGCTGCTCTGGAGG + Intergenic
1106475355 13:30093633-30093655 TTTGCTCCTCAGAGTTCTGGAGG - Intergenic
1107133022 13:36916753-36916775 TGTCCTCCTTCGAGCTCCTGTGG - Intronic
1107656951 13:42601369-42601391 TGTCCTCCCTGGACCTCTGCAGG - Intronic
1108128739 13:47274066-47274088 TGTGTTCCCTGGAGTTTTGGGGG + Intergenic
1108894492 13:55307758-55307780 TGTGGTTCTTGGAGTTGTGGGGG - Intergenic
1109045894 13:57410008-57410030 TGAGCTGCATGGAGCTGTGGGGG - Intergenic
1113109153 13:106803205-106803227 TGTGGTCCTTGCAGGTCTGGAGG - Intergenic
1113585691 13:111462767-111462789 TGTGCTCCTGGGAGCTACTGAGG + Intergenic
1114499345 14:23156456-23156478 AGTGGTACTTGGAGCTTTGGGGG - Intronic
1115491834 14:33965466-33965488 TGTGTTCCTTGTGGCTCTGAGGG - Intronic
1118185804 14:63537463-63537485 TGAGCTCCTGTGAGCTTTGGGGG - Intronic
1119687974 14:76648049-76648071 TTTGCTTCTAGGAGCTCTTGAGG + Intergenic
1119914517 14:78384739-78384761 TGTGCTCCATGGAATCCTGGAGG - Intronic
1120946780 14:90005254-90005276 TGTGTTCCTTGGAGCCCTGTGGG + Intronic
1121269935 14:92631281-92631303 TGTGCAGCTTGGCCCTCTGGGGG - Intronic
1121548180 14:94778418-94778440 CTTGCTCCTTGGATCTCTGTTGG + Intergenic
1122613012 14:102998878-102998900 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613036 14:102998951-102998973 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613060 14:102999024-102999046 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613083 14:102999097-102999119 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613107 14:102999170-102999192 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1122613130 14:102999243-102999265 TGTGCTCCCTGGGGCTCACGTGG - Intronic
1123430593 15:20212305-20212327 TGTAGTCCTTGGAGCTGAGGTGG - Intergenic
1125503589 15:40253802-40253824 GGTGCTGCTGGGAGCACTGGAGG + Intronic
1126066764 15:44831629-44831651 GGCTCTCCTTGGAGATCTGGAGG + Intergenic
1126093066 15:45068929-45068951 GGCTCTCCTTGGAGATCTGGAGG - Exonic
1126800866 15:52295573-52295595 TGGGCTCCTGGGAGCGCTGTGGG - Intronic
1127975174 15:63991636-63991658 TGTGTTCCCTGGAGCTTTTGGGG - Intronic
1128481760 15:68045887-68045909 TGGGCCCCAAGGAGCTCTGGGGG + Intergenic
1129702082 15:77773951-77773973 TGTCCCCTTTGGAGCCCTGGTGG - Intronic
1129704320 15:77785748-77785770 TCTGGTCCTTAGAGCTCGGGAGG - Intronic
1130001671 15:80053261-80053283 TGTGATCCATGAACCTCTGGAGG + Intergenic
1130027858 15:80285413-80285435 GTTGCTTCTTGGAGGTCTGGTGG + Intergenic
1131185802 15:90273015-90273037 TCTGCTCATTAGTGCTCTGGTGG + Exonic
1132940911 16:2507676-2507698 TGTGCTCCTGGGGCCTGTGGTGG + Intronic
1134117875 16:11562773-11562795 TGTGGTCCTGGCTGCTCTGGAGG + Intronic
1136233668 16:28902322-28902344 GGGGCTCCTTGGGGCTCCGGGGG - Exonic
1136854044 16:33638912-33638934 TGTAGTCCTTGGAGCTGAGGTGG + Intergenic
1137031817 16:35531659-35531681 TGCTCTCCTTAGAGCTCTTGTGG + Intergenic
1138391410 16:56672622-56672644 TGTGGTCCTAGCTGCTCTGGAGG + Intronic
1138494845 16:57401918-57401940 TGTGCTCCTTGGGGAAGTGGAGG - Intergenic
1140209577 16:72959854-72959876 GGTGCTCCATGTAGGTCTGGAGG + Exonic
1140918650 16:79516766-79516788 TGTGTACCCTGGAGCTCTAGAGG + Intergenic
1141432345 16:83976876-83976898 TGTGCTCCCAGCAGCTCTGCTGG - Intronic
1141896236 16:86960338-86960360 TGTGCTCCACGAAGCGCTGGGGG - Intergenic
1142305693 16:89283658-89283680 TGCGCTCCTTGCAGCTCTCCAGG + Exonic
1142643301 17:1297141-1297163 TGTGCTCCCTGGACCTGTGACGG + Intronic
1143472652 17:7185570-7185592 TCTGCTCCTTTCAGCACTGGTGG - Intergenic
1143775287 17:9195219-9195241 TGTGCTCCTTGGGGTGATGGAGG - Intronic
1143784592 17:9247157-9247179 TGTGGTCCTGGCAGCTCTGAGGG + Intergenic
1146798730 17:35801613-35801635 TGTGCTCCTTGCAAGTCTGCTGG - Intronic
1146821284 17:35985133-35985155 TGAGCTCCCTGGAGCTCTGGGGG + Intronic
1147306893 17:39570263-39570285 GGTGTTCCTTGGAGATCTGGTGG - Intergenic
1150227539 17:63532032-63532054 TGAGGGCCTTGCAGCTCTGGGGG + Intronic
1151687983 17:75660846-75660868 TGTGCTCCTTCGAGGGCTAGAGG - Intronic
1152414229 17:80148344-80148366 TGTGGTCCCAGGTGCTCTGGAGG - Intergenic
1152895904 17:82911088-82911110 GGTGCTCCTTGGGGTACTGGAGG + Intronic
1156134105 18:34015636-34015658 AGTGCTGCTTGAAGCTGTGGTGG - Intronic
1156808729 18:41221602-41221624 TGTGCTCCTTAGATGTCTTGTGG + Intergenic
1156977796 18:43245826-43245848 AGTGCACCTTGAATCTCTGGAGG - Intergenic
1157577348 18:48752410-48752432 AGTGCTCTTTGGAGAACTGGGGG - Intronic
1157594979 18:48858962-48858984 TGTGCCCCTTGGTGATCAGGGGG - Intronic
1157817215 18:50738326-50738348 TGGGTTCCTGGGGGCTCTGGCGG + Intergenic
1158534608 18:58296492-58296514 TGTGTTCCTAGAGGCTCTGGAGG - Intronic
1160853938 19:1207521-1207543 TCTGCTCCTTGGACAGCTGGGGG - Intronic
1163246100 19:16095403-16095425 TGGGCTTCTAGGAGCTCCGGTGG + Intronic
1163812787 19:19444417-19444439 TGTTCTCCTTGGGGCTCCTGAGG + Intronic
1164536727 19:29091618-29091640 TTGGCTCCTGGAAGCTCTGGGGG - Intergenic
1164758705 19:30710684-30710706 TATGATCCTTTGAGCCCTGGGGG + Intronic
1165106696 19:33474237-33474259 ACTGCTCCTTGCAGCTCTGAGGG - Intronic
1165160337 19:33812293-33812315 TCAGCTCGTGGGAGCTCTGGAGG - Intronic
1165489246 19:36113912-36113934 TGCGCTTCTTGGAACTCTGCCGG - Intronic
1165907533 19:39203148-39203170 GGGGCTCCTTGGAGCTCTTGGGG + Intronic
1166958275 19:46480614-46480636 TGTTCTCCTTTGAGCTGGGGCGG + Intergenic
1168213644 19:54909562-54909584 TGTGCTACCTGGAGCCCTGAGGG + Intronic
926684962 2:15691252-15691274 TGCCCTCCCTGGAGATCTGGAGG - Intronic
929467167 2:42155495-42155517 TGTGGTCCTTGCTGCTCTGGAGG + Intergenic
929539400 2:42808768-42808790 AGGGCTCCTTGGAGCACTTGTGG - Intergenic
930216228 2:48700194-48700216 TGAGCTCTTTGAAGATCTGGTGG + Intronic
931962722 2:67500059-67500081 TGTCCTCCCTGGAACTCTGCTGG - Intergenic
932134303 2:69214810-69214832 GGTGCTCCTTGGAGCTCTTTTGG + Intronic
932574361 2:72954648-72954670 TGTCCTCCCTGCAGCTGTGGGGG - Intronic
932855241 2:75226950-75226972 TAAGCTCCTTGCAGCTCAGGGGG - Intergenic
933355049 2:81199353-81199375 TGTGCTCCTTGGAGCTCTGGAGG + Intergenic
935333878 2:101997420-101997442 GGTGCTCCTCGGAGCTCTTCAGG - Intronic
935354784 2:102187869-102187891 TGTGGTCCTTGCTGCTCTGCGGG + Exonic
935756312 2:106278678-106278700 AGTGCTCCATGAAGCTCTGTGGG + Intergenic
936113167 2:109681799-109681821 AGTGCTCCATGAAGCTCTGTGGG - Intergenic
937269051 2:120635943-120635965 CGTGTTCCTTATAGCTCTGGAGG - Intergenic
937531842 2:122838239-122838261 TGGCCTCCTTGGAGGTCTTGTGG + Intergenic
937905904 2:127052676-127052698 CAGGCTCCTGGGAGCTCTGGAGG - Intronic
938254110 2:129841016-129841038 TGTGCTCCTAGGTACTCGGGAGG + Intergenic
938288087 2:130135586-130135608 GGTGCTCCCAGGAGCTCTTGGGG - Intergenic
940800162 2:158124288-158124310 TGTGCCACTTGGATATCTGGGGG + Intronic
943681679 2:190774828-190774850 GCTCCTCCTTGGACCTCTGGTGG + Intergenic
943684972 2:190808904-190808926 TGTTGTCCTAGGAGCTCTGGAGG - Intergenic
945565027 2:211387073-211387095 TGTGCTAGTTGGGGCTCTGTAGG + Exonic
946872905 2:224100900-224100922 TGAGCCCTTTGGAGATCTGGAGG - Intergenic
947178772 2:227393685-227393707 AGCCTTCCTTGGAGCTCTGGGGG + Intergenic
947713985 2:232330798-232330820 TGTGCTCCTGGGAGCAGGGGAGG - Intronic
947727791 2:232410522-232410544 GGTGCTCCTCGGAACTCAGGTGG - Exonic
947876756 2:233472772-233472794 TGTGATGCCTGGAGCTGTGGTGG - Intergenic
1169640355 20:7744142-7744164 TGACCTCCTTGGAGTTCTTGTGG - Intergenic
1169930143 20:10823772-10823794 GGTGCTCCTGGGAGCTTTTGAGG - Intergenic
1170431882 20:16283542-16283564 TGTGATCCATGGAGACCTGGCGG - Intronic
1171171502 20:23019468-23019490 TGAACTCCTTGCAGCTCTGGGGG - Intergenic
1171772432 20:29334011-29334033 GCTCCTCCTTGGACCTCTGGTGG - Intergenic
1172152253 20:32798668-32798690 TGTGCCCCTGGGATCTGTGGTGG - Intronic
1173436113 20:43033695-43033717 TGAGCTCCTTGCAGATTTGGAGG - Intronic
1174312223 20:49666366-49666388 GGTGCTGCTTGGTGCTCAGGGGG + Intronic
1174375889 20:50126409-50126431 TGTGCTCCTTGGAAGGCAGGTGG - Intronic
1174487942 20:50872916-50872938 TGTTCTCCTTGGAGCCCCTGGGG + Intronic
1176083781 20:63286716-63286738 TGTGCTCTTTGGAACCCTGCAGG + Intronic
1178705971 21:34873206-34873228 TGTGCTCATCAGATCTCTGGAGG - Intronic
1179656933 21:42851459-42851481 GAGGTTCCTTGGAGCTCTGGAGG - Intronic
1179826530 21:43969111-43969133 CGAGGACCTTGGAGCTCTGGAGG - Exonic
1180636062 22:17264041-17264063 TGTGCTGGGTGCAGCTCTGGGGG - Intergenic
1180917885 22:19501475-19501497 TGGCCTCCTTGGAGGTCTTGTGG + Intronic
1182699747 22:32226931-32226953 TGAGCCCCATGGTGCTCTGGGGG - Intronic
1183017344 22:34999950-34999972 TCTCCTCTTGGGAGCTCTGGTGG - Intergenic
1183241299 22:36659934-36659956 TGTCCTCCCTGCAGCTCTGGTGG - Intronic
1184090027 22:42288059-42288081 TGTTCTCCTGGGAGCTCAAGAGG - Intronic
1185226278 22:49655302-49655324 TGTACCCCCTGGAGCTCTGCTGG + Intronic
1185232123 22:49689331-49689353 TGTACTTCCTGGAGCTCTGAGGG - Intergenic
949198252 3:1339285-1339307 TATGCTCCTTGGAGAGCTAGGGG - Intronic
949678203 3:6482251-6482273 TGTGTTCCTTACAGTTCTGGAGG - Intergenic
949919974 3:8992940-8992962 TGTGCTCCGTGGGGGACTGGAGG + Exonic
950040562 3:9916871-9916893 TGTCCTCCTTAGGGCTCCGGGGG + Intergenic
950493192 3:13318604-13318626 GGTGCTCCCTGGAGCTGTGCAGG + Intronic
950929307 3:16773248-16773270 TCTGCTCCATGAAGCTCTTGAGG - Intergenic
951643451 3:24861871-24861893 TGTGATCCAGGGAGCCCTGGTGG - Intergenic
952386979 3:32848941-32848963 TGAGTTCCCTGAAGCTCTGGGGG + Intronic
953900640 3:46840137-46840159 TGTAGTCCTAGGTGCTCTGGAGG + Intergenic
954649239 3:52150176-52150198 TGTGCTCCTTGGAGAACTCTGGG - Intronic
955112505 3:55962876-55962898 TGTGCTCCATAGAGCTTTGTAGG - Intronic
955767479 3:62360025-62360047 TGGGCAATTTGGAGCTCTGGGGG + Intergenic
960001744 3:112739467-112739489 TGTGCTTCATGGAGCCCTAGGGG - Intergenic
961493019 3:127268435-127268457 TTCTCTCCTTGGAGATCTGGGGG + Intergenic
963544906 3:146644270-146644292 TGAGCCCCTTGCAGTTCTGGTGG + Intergenic
964932953 3:162048111-162048133 AGTGCTCCTTGGAGATCTGAAGG - Intergenic
965576297 3:170221964-170221986 CGTGCTCCCTGGAGCTGTCGGGG - Intergenic
966331272 3:178817549-178817571 TGTGCTCACTGAAGCTCTGAAGG + Intronic
967297736 3:187981754-187981776 TGGGGACCCTGGAGCTCTGGGGG + Intergenic
967878537 3:194282740-194282762 TGTGCTCCTCTGAGCCCTGGAGG - Intergenic
968005452 3:195239433-195239455 TGTTCTTCTTGCAGCTCTCGAGG - Intronic
968500104 4:945892-945914 TGTGCTACTTGGAAATGTGGGGG - Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
970517251 4:16845162-16845184 TGTGGTCCCTGAAGCTCTAGAGG + Intronic
972432765 4:38999719-38999741 TCTGTTCCTTGGCCCTCTGGTGG + Intronic
973288860 4:48449574-48449596 TGTGTTGCTTGGAGGTATGGTGG - Intergenic
974267057 4:59598822-59598844 TGTGCTGCCTGGAGCTGGGGAGG - Intergenic
976224994 4:82788821-82788843 TGTGCTGCCCGGAACTCTGGCGG + Intronic
979965459 4:127071466-127071488 TGTTCTCCTTTGAACTCAGGGGG - Intergenic
980947730 4:139339373-139339395 TGTGGTCCTAGCTGCTCTGGAGG + Intronic
983477769 4:168236274-168236296 TGTGCATCTTGGAACTTTGGTGG + Exonic
983869956 4:172813683-172813705 TCTGCCCTCTGGAGCTCTGGAGG - Exonic
984467210 4:180115889-180115911 TATCTTCCTTGGAGCTCTTGTGG + Intergenic
986283474 5:6343059-6343081 TGAGCTCCGTGGAGAGCTGGTGG + Intergenic
988025496 5:25682427-25682449 TGTGCCCCATTGAGCTCTGGAGG + Intergenic
988859593 5:35263836-35263858 TGTGGTCCACGGACCTCTGGGGG - Intergenic
991047832 5:62241270-62241292 TGTAGTCCTTGGAGCTGAGGTGG - Intergenic
991124086 5:63050096-63050118 TGTGCTCCATGGAGATATTGGGG + Intergenic
991513649 5:67409300-67409322 TTCCCTGCTTGGAGCTCTGGAGG - Intergenic
992955275 5:81901746-81901768 TGTGCTCCTGGGAGCCCTCCAGG - Intergenic
993132995 5:83922876-83922898 TGTGCCACTTTGAGCTCAGGAGG + Intergenic
995560745 5:113378602-113378624 TGTGCTTCTCAGAGCTTTGGGGG - Intronic
995883872 5:116871150-116871172 AGGGCTACCTGGAGCTCTGGGGG + Intergenic
996877856 5:128259742-128259764 TGTGCTCCTTAGAGCCGAGGTGG + Exonic
996976384 5:129439775-129439797 TGGGCCCCTTGGAGCTTTAGAGG + Intergenic
998503701 5:142654990-142655012 TGTTTTCCTTGGAGCTGGGGTGG - Intronic
1000388894 5:160702036-160702058 AGTGCTCCCAGGAGCACTGGGGG - Intronic
1001175116 5:169461355-169461377 TGTCCTCCTTGGAGCTTCTGGGG + Intergenic
1002523069 5:179801874-179801896 TGAGCTCCTTGGAGCGCTTGAGG + Exonic
1002603536 5:180368961-180368983 TGTGCTCAGTGGAGCTCTTGGGG - Intergenic
1002839350 6:892792-892814 GGTGGTGCATGGAGCTCTGGGGG - Intergenic
1003760182 6:9171212-9171234 TGTGCTCCTGGGAGAACAGGGGG + Intergenic
1005375827 6:25181296-25181318 AGTTCTCTTTGGAGCTTTGGTGG - Intergenic
1007257773 6:40540784-40540806 TGTGCTCCTTGGGCATCTGGGGG - Intronic
1007335247 6:41150864-41150886 TGTGCTCCTGGTAGGTCTGCTGG - Exonic
1007833054 6:44653516-44653538 TCTGCTCCTTGAAGCTCTGGAGG - Intergenic
1009511177 6:64551656-64551678 TGTGGTCCTTGGTACTCAGGAGG - Intronic
1011262116 6:85480628-85480650 TGTGCTCGGAGGGGCTCTGGTGG + Intronic
1012499545 6:99873802-99873824 TTTGCTGCTTTGAGCTCTTGAGG + Intergenic
1013272804 6:108559398-108559420 TGCGCTCCTTGGAGCGTCGGGGG + Intergenic
1014032042 6:116717312-116717334 TGTGATCCATGGACCCCTGGGGG - Intronic
1015855349 6:137618344-137618366 TTTGGACCTTGGAGCTCTGCAGG + Intergenic
1015953910 6:138580999-138581021 TTTGCTTCTTCCAGCTCTGGTGG - Intronic
1016866136 6:148769002-148769024 TGTCCTCCCTGGACCTCTGTTGG + Intronic
1018127133 6:160692434-160692456 TGTGCTTTTTGGTGCTGTGGTGG - Intergenic
1019521930 7:1464767-1464789 TGTGCTCCTTGAAGGTGGGGGGG - Intergenic
1019706224 7:2498445-2498467 TGTGCAGCTTGGAGCTCGTGAGG - Intergenic
1019769574 7:2875251-2875273 TGTCCTCCTGGAAGCTCTAGGGG + Intergenic
1020045610 7:5037987-5038009 TGGGCGCCTGGGAGCTCAGGTGG - Intronic
1020266609 7:6564768-6564790 TGTGGTCCTAGCTGCTCTGGAGG - Intergenic
1020291011 7:6722176-6722198 TGGGCTCCTGGGAGCTCAGCTGG - Intergenic
1023675323 7:42622764-42622786 TGTGCTCGATGGAACCCTGGGGG + Intergenic
1023781711 7:43661729-43661751 TGTGGTCCTTGTACCTCTGGAGG + Intronic
1023980246 7:45065381-45065403 TGGGCTCCTTGGATCTCTGCTGG + Intronic
1027474668 7:78614239-78614261 TTTACTCCTTAGAACTCTGGGGG + Intronic
1031769535 7:125826177-125826199 TGTGGTCTGTGGAACTCTGGGGG + Intergenic
1032544742 7:132732196-132732218 TGTGCCCCTTGGAACTCTCCTGG - Intergenic
1033241252 7:139681797-139681819 TCTGCTCCCTGGAGCAGTGGTGG - Intronic
1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG + Intergenic
1034670383 7:152853280-152853302 TGTGTTCCTTTGAGCGCTGGGGG + Intronic
1035278703 7:157763859-157763881 TGGGCACCGTGGTGCTCTGGGGG - Intronic
1035962087 8:4148535-4148557 TTGGCTACTTGGAGTTCTGGAGG + Intronic
1036635237 8:10546051-10546073 TTTGCTCCTTGGACCTCAGATGG - Intronic
1036783750 8:11671358-11671380 TGTGCTCCTTGGAGTTTGGCTGG - Intergenic
1040549005 8:48423985-48424007 TGAGAACCTTGGAGCTATGGTGG - Intergenic
1040883786 8:52237081-52237103 TGTGATCCTTGGAGCTCTAGAGG - Intronic
1041037951 8:53814330-53814352 CGTGCTCTTTGGAGCTGTGTGGG + Intronic
1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG + Intronic
1042847934 8:73186896-73186918 TGGGCTCCCAGGAGCTCAGGAGG + Intergenic
1044066347 8:87704262-87704284 TGAGCTGCCTGGAGCTGTGGGGG - Intergenic
1045063194 8:98425735-98425757 GGTGCTCTGTGTAGCTCTGGAGG - Intronic
1046411210 8:113845353-113845375 TGTGCTGCTTGGGGCACTGTGGG - Intergenic
1047166444 8:122444611-122444633 TGTGCTCCGGGGACCTCTGGAGG - Intergenic
1047456378 8:125016989-125017011 TGAGCTGCCTGGAGCTGTGGGGG + Intronic
1048939298 8:139384490-139384512 TGTGATCCTCTGAGCCCTGGAGG - Intergenic
1049118647 8:140713586-140713608 TGTAGTCCTTGGACCTCTGTAGG - Intronic
1049689529 8:143952631-143952653 TGGGGCCCTTGGAGATCTGGGGG - Intronic
1050520815 9:6498099-6498121 CCTGCTCCTTGGACCTCTGAAGG + Exonic
1050810830 9:9745384-9745406 TGTGCTACTTGCCTCTCTGGTGG - Intronic
1052048375 9:23821033-23821055 CGCGGTCCTTGGAGCTCTCGGGG - Intronic
1056235618 9:84590927-84590949 TGTGCTCATTGGAGGCCTGGTGG + Intergenic
1057164088 9:92912972-92912994 TCTGCTCCTTGGAGCTCCAGCGG + Intergenic
1057240035 9:93399989-93400011 GGTTCTCCTGGGAGCTCTGGGGG - Intergenic
1057706312 9:97397578-97397600 TGTATTCCTTGCAGTTCTGGAGG + Intergenic
1061115715 9:128610171-128610193 TGTGTTCCTTGAAGATTTGGAGG - Intronic
1061297378 9:129684097-129684119 TGTGCTCCCTGCAGACCTGGGGG + Intronic
1061407772 9:130402244-130402266 TGTGCTCCGTGGGCCCCTGGGGG - Intronic
1061744356 9:132728647-132728669 TGTCCTCCTTGGAGAGGTGGAGG + Intronic
1062291474 9:135797179-135797201 TGGGCTCCTCGGAGGTCAGGAGG - Intergenic
1062629498 9:137457533-137457555 GGCACTCCTTGGAGCCCTGGCGG + Exonic
1185473802 X:401141-401163 TGTGGTCCCTGGTGCTCAGGAGG - Intergenic
1185838549 X:3367875-3367897 AGAGCTCCTAGGAGGTCTGGTGG - Intergenic
1186154949 X:6715809-6715831 TGTGCTTCTTGCAGTTCTGAGGG - Intergenic
1186835140 X:13430218-13430240 TTTGCTACTTGGAGCTGAGGGGG - Intergenic
1188253559 X:27930249-27930271 TGTGTTTCTCGCAGCTCTGGAGG + Intergenic
1190036675 X:47031741-47031763 TGTGCTCCTAGGTACTCGGGAGG + Intronic
1192762451 X:74107411-74107433 CCTGCTCCTTGGACCTCTGAAGG + Intergenic
1195143406 X:101987223-101987245 TGTACTCCTAGCTGCTCTGGAGG + Intergenic
1200055583 X:153458309-153458331 TGTGCTCCAAGGTGATCTGGGGG + Intronic
1200154516 X:153968351-153968373 TGTGCCCCTTGCAGTTCTGCGGG - Intronic
1201151827 Y:11098992-11099014 GGTGCGCCTCGGACCTCTGGGGG - Intergenic
1201237212 Y:11923021-11923043 AGAGCTCCTAGGAGGTCTGGTGG + Intergenic
1202273340 Y:23091414-23091436 TGTGATGCTTGGAGCTGTTGCGG + Intergenic
1202292686 Y:23329268-23329290 TGTGATGCTTGGAGCTGTTGCGG - Intergenic
1202426337 Y:24725158-24725180 TGTGATGCTTGGAGCTGTTGCGG + Intergenic
1202444452 Y:24944928-24944950 TGTGATGCTTGGAGCTGTTGCGG - Intergenic