ID: 933362355

View in Genome Browser
Species Human (GRCh38)
Location 2:81304456-81304478
Sequence CCCAGCTGGTACCCCAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933362347_933362355 15 Left 933362347 2:81304418-81304440 CCTAGAAAGACAGTGTTGGGGAA No data
Right 933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG No data
933362343_933362355 28 Left 933362343 2:81304405-81304427 CCAACATGAGTCTCCTAGAAAGA No data
Right 933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG No data
933362348_933362355 -9 Left 933362348 2:81304442-81304464 CCAGCCCCACACCACCCAGCTGG No data
Right 933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933362355 Original CRISPR CCCAGCTGGTACCCCAAGTC CGG Intergenic
No off target data available for this crispr