ID: 933367139

View in Genome Browser
Species Human (GRCh38)
Location 2:81367367-81367389
Sequence ATTTAAGCACAGAACTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933367138_933367139 -2 Left 933367138 2:81367346-81367368 CCAAAAATAATGTATCATTATAT No data
Right 933367139 2:81367367-81367389 ATTTAAGCACAGAACTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933367139 Original CRISPR ATTTAAGCACAGAACTAGCT TGG Intergenic
No off target data available for this crispr