ID: 933367139 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:81367367-81367389 |
| Sequence | ATTTAAGCACAGAACTAGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933367138_933367139 | -2 | Left | 933367138 | 2:81367346-81367368 | CCAAAAATAATGTATCATTATAT | No data | ||
| Right | 933367139 | 2:81367367-81367389 | ATTTAAGCACAGAACTAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933367139 | Original CRISPR | ATTTAAGCACAGAACTAGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||