ID: 933369191

View in Genome Browser
Species Human (GRCh38)
Location 2:81393776-81393798
Sequence CCATAGAGACCATCATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933369191_933369195 -5 Left 933369191 2:81393776-81393798 CCATCCCATGATGGTCTCTATGG No data
Right 933369195 2:81393794-81393816 TATGGCAGACACATAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933369191 Original CRISPR CCATAGAGACCATCATGGGA TGG (reversed) Intergenic
No off target data available for this crispr