ID: 933381194

View in Genome Browser
Species Human (GRCh38)
Location 2:81548218-81548240
Sequence CTTTAAGAATGGTTGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933381194_933381197 18 Left 933381194 2:81548218-81548240 CCAAATTCCAACCATTCTTAAAG No data
Right 933381197 2:81548259-81548281 AGTTGAATGATCCTCCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933381194 Original CRISPR CTTTAAGAATGGTTGGAATT TGG (reversed) Intergenic
No off target data available for this crispr