ID: 933381197

View in Genome Browser
Species Human (GRCh38)
Location 2:81548259-81548281
Sequence AGTTGAATGATCCTCCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933381196_933381197 7 Left 933381196 2:81548229-81548251 CCATTCTTAAAGTATTAAAATTA No data
Right 933381197 2:81548259-81548281 AGTTGAATGATCCTCCTAAATGG No data
933381195_933381197 11 Left 933381195 2:81548225-81548247 CCAACCATTCTTAAAGTATTAAA No data
Right 933381197 2:81548259-81548281 AGTTGAATGATCCTCCTAAATGG No data
933381194_933381197 18 Left 933381194 2:81548218-81548240 CCAAATTCCAACCATTCTTAAAG No data
Right 933381197 2:81548259-81548281 AGTTGAATGATCCTCCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933381197 Original CRISPR AGTTGAATGATCCTCCTAAA TGG Intergenic
No off target data available for this crispr