ID: 933382502

View in Genome Browser
Species Human (GRCh38)
Location 2:81567208-81567230
Sequence ACATATAGAAAACAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933382500_933382502 21 Left 933382500 2:81567164-81567186 CCAGTCTCAGGTATTTCTTTATA 0: 1380
1: 4585
2: 9837
3: 11850
4: 13142
Right 933382502 2:81567208-81567230 ACATATAGAAAACAGTGTGGAGG No data
933382499_933382502 22 Left 933382499 2:81567163-81567185 CCCAGTCTCAGGTATTTCTTTAT 0: 1358
1: 7328
2: 11159
3: 12818
4: 11820
Right 933382502 2:81567208-81567230 ACATATAGAAAACAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933382502 Original CRISPR ACATATAGAAAACAGTGTGG AGG Intergenic
No off target data available for this crispr