ID: 933385490

View in Genome Browser
Species Human (GRCh38)
Location 2:81605738-81605760
Sequence GTGTCTAGGTAGAAGAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933385490_933385499 25 Left 933385490 2:81605738-81605760 CCATGACTCTTCTACCTAGACAC No data
Right 933385499 2:81605786-81605808 TACAGTTCTTTTATCTTTTTAGG No data
933385490_933385500 30 Left 933385490 2:81605738-81605760 CCATGACTCTTCTACCTAGACAC No data
Right 933385500 2:81605791-81605813 TTCTTTTATCTTTTTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933385490 Original CRISPR GTGTCTAGGTAGAAGAGTCA TGG (reversed) Intergenic
No off target data available for this crispr