ID: 933391285

View in Genome Browser
Species Human (GRCh38)
Location 2:81671340-81671362
Sequence GCTGGGACATGTAGAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933391278_933391285 23 Left 933391278 2:81671294-81671316 CCAATTTGACAAAATGTTTATCT No data
Right 933391285 2:81671340-81671362 GCTGGGACATGTAGAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933391285 Original CRISPR GCTGGGACATGTAGAGCTGA TGG Intergenic
No off target data available for this crispr