ID: 933391545

View in Genome Browser
Species Human (GRCh38)
Location 2:81675074-81675096
Sequence AGGTCTCAGCCTATTTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933391543_933391545 -8 Left 933391543 2:81675059-81675081 CCATGCTCCGAGAACAGGTCTCA No data
Right 933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG No data
933391541_933391545 1 Left 933391541 2:81675050-81675072 CCATACTATCCATGCTCCGAGAA No data
Right 933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG No data
933391540_933391545 2 Left 933391540 2:81675049-81675071 CCCATACTATCCATGCTCCGAGA No data
Right 933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG No data
933391539_933391545 30 Left 933391539 2:81675021-81675043 CCATAAATTATCAAGTGGGACAT No data
Right 933391545 2:81675074-81675096 AGGTCTCAGCCTATTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933391545 Original CRISPR AGGTCTCAGCCTATTTCATG AGG Intergenic
No off target data available for this crispr