ID: 933395119

View in Genome Browser
Species Human (GRCh38)
Location 2:81721548-81721570
Sequence CAGAATAGACAGAAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933395118_933395119 21 Left 933395118 2:81721504-81721526 CCACTCAGGATTATGATTTAGGA No data
Right 933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933395119 Original CRISPR CAGAATAGACAGAAGCAGTG AGG Intergenic
No off target data available for this crispr