ID: 933400280

View in Genome Browser
Species Human (GRCh38)
Location 2:81787729-81787751
Sequence TTCTGGGACATCAGGTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400280_933400290 24 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data
933400280_933400288 22 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400288 2:81787774-81787796 TCAATGAGGAGGTCTGATTCAGG No data
933400280_933400285 11 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data
933400280_933400289 23 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data
933400280_933400284 8 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933400280 Original CRISPR TTCTGGGACATCAGGTAAGT AGG (reversed) Intergenic
No off target data available for this crispr