ID: 933400282

View in Genome Browser
Species Human (GRCh38)
Location 2:81787745-81787767
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400282_933400290 8 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data
933400282_933400288 6 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400288 2:81787774-81787796 TCAATGAGGAGGTCTGATTCAGG No data
933400282_933400284 -8 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400282_933400289 7 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data
933400282_933400285 -5 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933400282 Original CRISPR GGTAACTGATGTGCTGTTCT GGG (reversed) Intergenic