ID: 933400284

View in Genome Browser
Species Human (GRCh38)
Location 2:81787760-81787782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400282_933400284 -8 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400279_933400284 27 Left 933400279 2:81787710-81787732 CCTTAGAACTTAGGAATTACCTA No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400277_933400284 29 Left 933400277 2:81787708-81787730 CCCCTTAGAACTTAGGAATTACC No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400283_933400284 -9 Left 933400283 2:81787746-81787768 CCAGAACAGCACATCAGTTACCC No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400278_933400284 28 Left 933400278 2:81787709-81787731 CCCTTAGAACTTAGGAATTACCT No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400281_933400284 0 Left 933400281 2:81787737-81787759 CCTGATGTCCCAGAACAGCACAT No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data
933400280_933400284 8 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400284 2:81787760-81787782 CAGTTACCCTGATGTCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type