ID: 933400285

View in Genome Browser
Species Human (GRCh38)
Location 2:81787763-81787785
Sequence TTACCCTGATGTCAATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400280_933400285 11 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data
933400282_933400285 -5 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data
933400279_933400285 30 Left 933400279 2:81787710-81787732 CCTTAGAACTTAGGAATTACCTA No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data
933400283_933400285 -6 Left 933400283 2:81787746-81787768 CCAGAACAGCACATCAGTTACCC No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data
933400281_933400285 3 Left 933400281 2:81787737-81787759 CCTGATGTCCCAGAACAGCACAT No data
Right 933400285 2:81787763-81787785 TTACCCTGATGTCAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933400285 Original CRISPR TTACCCTGATGTCAATGAGG AGG Intergenic
No off target data available for this crispr