ID: 933400289

View in Genome Browser
Species Human (GRCh38)
Location 2:81787775-81787797
Sequence CAATGAGGAGGTCTGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400280_933400289 23 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data
933400281_933400289 15 Left 933400281 2:81787737-81787759 CCTGATGTCCCAGAACAGCACAT No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data
933400282_933400289 7 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data
933400283_933400289 6 Left 933400283 2:81787746-81787768 CCAGAACAGCACATCAGTTACCC No data
Right 933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933400289 Original CRISPR CAATGAGGAGGTCTGATTCA GGG Intergenic
No off target data available for this crispr