ID: 933400290

View in Genome Browser
Species Human (GRCh38)
Location 2:81787776-81787798
Sequence AATGAGGAGGTCTGATTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933400281_933400290 16 Left 933400281 2:81787737-81787759 CCTGATGTCCCAGAACAGCACAT No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data
933400282_933400290 8 Left 933400282 2:81787745-81787767 CCCAGAACAGCACATCAGTTACC No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data
933400280_933400290 24 Left 933400280 2:81787729-81787751 CCTACTTACCTGATGTCCCAGAA No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data
933400283_933400290 7 Left 933400283 2:81787746-81787768 CCAGAACAGCACATCAGTTACCC No data
Right 933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933400290 Original CRISPR AATGAGGAGGTCTGATTCAG GGG Intergenic
No off target data available for this crispr