ID: 933401191

View in Genome Browser
Species Human (GRCh38)
Location 2:81797656-81797678
Sequence AGGCTTGTACAAATTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933401189_933401191 1 Left 933401189 2:81797632-81797654 CCAGCAATCATCTAATATATTGT No data
Right 933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG No data
933401187_933401191 14 Left 933401187 2:81797619-81797641 CCTCTACTCCTGGCCAGCAATCA No data
Right 933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG No data
933401188_933401191 6 Left 933401188 2:81797627-81797649 CCTGGCCAGCAATCATCTAATAT No data
Right 933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933401191 Original CRISPR AGGCTTGTACAAATTGAGTA TGG Intergenic
No off target data available for this crispr