ID: 933401983

View in Genome Browser
Species Human (GRCh38)
Location 2:81809912-81809934
Sequence GGGTGGGTCATTGAAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933401976_933401983 12 Left 933401976 2:81809877-81809899 CCAGACAATAGGCAAGATTTTGT No data
Right 933401983 2:81809912-81809934 GGGTGGGTCATTGAAAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933401983 Original CRISPR GGGTGGGTCATTGAAAAATG AGG Intergenic
No off target data available for this crispr