ID: 933412170

View in Genome Browser
Species Human (GRCh38)
Location 2:81940352-81940374
Sequence TCTCTTGTGGAGGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933412170_933412181 -2 Left 933412170 2:81940352-81940374 CCCCCCACCCCCTCCACAAGAGA No data
Right 933412181 2:81940373-81940395 GAGATAATTTATTGAGCAGAGGG No data
933412170_933412180 -3 Left 933412170 2:81940352-81940374 CCCCCCACCCCCTCCACAAGAGA No data
Right 933412180 2:81940372-81940394 AGAGATAATTTATTGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933412170 Original CRISPR TCTCTTGTGGAGGGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr