ID: 933418910

View in Genome Browser
Species Human (GRCh38)
Location 2:82023196-82023218
Sequence CCCAGTGGGTACCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933418910_933418922 20 Left 933418910 2:82023196-82023218 CCAGACTCAGGGTACCCACTGGG No data
Right 933418922 2:82023239-82023261 CAACACCTGGTGCCCAATGTGGG No data
933418910_933418918 7 Left 933418910 2:82023196-82023218 CCAGACTCAGGGTACCCACTGGG No data
Right 933418918 2:82023226-82023248 GGGCTGTTTTGCCCAACACCTGG No data
933418910_933418921 19 Left 933418910 2:82023196-82023218 CCAGACTCAGGGTACCCACTGGG No data
Right 933418921 2:82023238-82023260 CCAACACCTGGTGCCCAATGTGG No data
933418910_933418923 21 Left 933418910 2:82023196-82023218 CCAGACTCAGGGTACCCACTGGG No data
Right 933418923 2:82023240-82023262 AACACCTGGTGCCCAATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933418910 Original CRISPR CCCAGTGGGTACCCTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr