ID: 933419624

View in Genome Browser
Species Human (GRCh38)
Location 2:82029125-82029147
Sequence CAATTTAAACATCCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933419624_933419627 19 Left 933419624 2:82029125-82029147 CCAGATGCAGGATGTTTAAATTG No data
Right 933419627 2:82029167-82029189 GTTTATGTCCCTACACATAATGG No data
933419624_933419625 -7 Left 933419624 2:82029125-82029147 CCAGATGCAGGATGTTTAAATTG No data
Right 933419625 2:82029141-82029163 TAAATTGTGATAAACAAAGTTGG No data
933419624_933419626 -3 Left 933419624 2:82029125-82029147 CCAGATGCAGGATGTTTAAATTG No data
Right 933419626 2:82029145-82029167 TTGTGATAAACAAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933419624 Original CRISPR CAATTTAAACATCCTGCATC TGG (reversed) Intergenic
No off target data available for this crispr