ID: 933419855

View in Genome Browser
Species Human (GRCh38)
Location 2:82031232-82031254
Sequence CCCAGTGGGTACCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933419855_933419860 -9 Left 933419855 2:82031232-82031254 CCAGACTCAGGGTACCCACTGGG No data
Right 933419860 2:82031246-82031268 CCCACTGGGTGGAGTGGAGCTGG No data
933419855_933419865 28 Left 933419855 2:82031232-82031254 CCAGACTCAGGGTACCCACTGGG No data
Right 933419865 2:82031283-82031305 TTTATGCAAATTTCTGCAGCTGG 0: 63
1: 1021
2: 1159
3: 767
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933419855 Original CRISPR CCCAGTGGGTACCCTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr