ID: 933423101

View in Genome Browser
Species Human (GRCh38)
Location 2:82077124-82077146
Sequence ATGGACTACGTGGTGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933423087_933423101 25 Left 933423087 2:82077076-82077098 CCAGCCTTTTTGGCACCAGAGAC No data
Right 933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG No data
933423085_933423101 27 Left 933423085 2:82077074-82077096 CCCCAGCCTTTTTGGCACCAGAG No data
Right 933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG No data
933423092_933423101 10 Left 933423092 2:82077091-82077113 CCAGAGACTGGTTTCATGGGAGA No data
Right 933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG No data
933423086_933423101 26 Left 933423086 2:82077075-82077097 CCCAGCCTTTTTGGCACCAGAGA No data
Right 933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG No data
933423089_933423101 21 Left 933423089 2:82077080-82077102 CCTTTTTGGCACCAGAGACTGGT No data
Right 933423101 2:82077124-82077146 ATGGACTACGTGGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933423101 Original CRISPR ATGGACTACGTGGTGGGGTG GGG Intergenic