ID: 933423477

View in Genome Browser
Species Human (GRCh38)
Location 2:82081814-82081836
Sequence GCTATTAGTCTGATGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933423476_933423477 -9 Left 933423476 2:82081800-82081822 CCTAAAATATATGAGCTATTAGT No data
Right 933423477 2:82081814-82081836 GCTATTAGTCTGATGCAAGCAGG No data
933423475_933423477 1 Left 933423475 2:82081790-82081812 CCTATGTGTTCCTAAAATATATG No data
Right 933423477 2:82081814-82081836 GCTATTAGTCTGATGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933423477 Original CRISPR GCTATTAGTCTGATGCAAGC AGG Intergenic
No off target data available for this crispr