ID: 933425300

View in Genome Browser
Species Human (GRCh38)
Location 2:82103652-82103674
Sequence GTAATTCTCCAGTTTTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933425300_933425301 11 Left 933425300 2:82103652-82103674 CCAATAGAAAACTGGAGAATTAC No data
Right 933425301 2:82103686-82103708 TATATGACATCCTACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933425300 Original CRISPR GTAATTCTCCAGTTTTCTAT TGG (reversed) Intergenic
No off target data available for this crispr